ID: 1160252683

View in Genome Browser
Species Human (GRCh38)
Location 18:77217193-77217215
Sequence GTGTTGCACTGTTCCCGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160252681_1160252683 -10 Left 1160252681 18:77217180-77217202 CCAGAGTGCACACGTGTTGCACT No data
Right 1160252683 18:77217193-77217215 GTGTTGCACTGTTCCCGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160252683 Original CRISPR GTGTTGCACTGTTCCCGCGT GGG Intergenic
No off target data available for this crispr