ID: 1160254867

View in Genome Browser
Species Human (GRCh38)
Location 18:77239699-77239721
Sequence AATGAGGAGCAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160254867_1160254871 -4 Left 1160254867 18:77239699-77239721 CCTTCCTCACTCTGCTCCTCATT No data
Right 1160254871 18:77239718-77239740 CATTTCTCTTAACTTCTGAAGGG No data
1160254867_1160254870 -5 Left 1160254867 18:77239699-77239721 CCTTCCTCACTCTGCTCCTCATT No data
Right 1160254870 18:77239717-77239739 TCATTTCTCTTAACTTCTGAAGG No data
1160254867_1160254872 12 Left 1160254867 18:77239699-77239721 CCTTCCTCACTCTGCTCCTCATT No data
Right 1160254872 18:77239734-77239756 TGAAGGGCCCCTGAGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160254867 Original CRISPR AATGAGGAGCAGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr