ID: 1160254970

View in Genome Browser
Species Human (GRCh38)
Location 18:77240449-77240471
Sequence CAAAATAACTAGAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160254970_1160254979 14 Left 1160254970 18:77240449-77240471 CCAGCCCCCTTCTAGTTATTTTG No data
Right 1160254979 18:77240486-77240508 AATGGAATAGAGGGATAGGTAGG No data
1160254970_1160254978 10 Left 1160254970 18:77240449-77240471 CCAGCCCCCTTCTAGTTATTTTG No data
Right 1160254978 18:77240482-77240504 TAGAAATGGAATAGAGGGATAGG No data
1160254970_1160254977 5 Left 1160254970 18:77240449-77240471 CCAGCCCCCTTCTAGTTATTTTG No data
Right 1160254977 18:77240477-77240499 AAACTTAGAAATGGAATAGAGGG No data
1160254970_1160254975 -4 Left 1160254970 18:77240449-77240471 CCAGCCCCCTTCTAGTTATTTTG No data
Right 1160254975 18:77240468-77240490 TTTGATGCAAAACTTAGAAATGG No data
1160254970_1160254976 4 Left 1160254970 18:77240449-77240471 CCAGCCCCCTTCTAGTTATTTTG No data
Right 1160254976 18:77240476-77240498 AAAACTTAGAAATGGAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160254970 Original CRISPR CAAAATAACTAGAAGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr