ID: 1160256499 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:77251775-77251797 |
Sequence | AACTGCGCACCCCGGGGGAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160256499_1160256504 | -6 | Left | 1160256499 | 18:77251775-77251797 | CCTCTCCCCCGGGGTGCGCAGTT | No data | ||
Right | 1160256504 | 18:77251792-77251814 | GCAGTTTGCCCTCGCTCCGAAGG | No data | ||||
1160256499_1160256509 | 10 | Left | 1160256499 | 18:77251775-77251797 | CCTCTCCCCCGGGGTGCGCAGTT | No data | ||
Right | 1160256509 | 18:77251808-77251830 | CCGAAGGCTTTGCGCACACCGGG | No data | ||||
1160256499_1160256507 | 9 | Left | 1160256499 | 18:77251775-77251797 | CCTCTCCCCCGGGGTGCGCAGTT | No data | ||
Right | 1160256507 | 18:77251807-77251829 | TCCGAAGGCTTTGCGCACACCGG | 0: 1 1: 0 2: 0 3: 2 4: 41 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160256499 | Original CRISPR | AACTGCGCACCCCGGGGGAG AGG (reversed) | Intronic | ||