ID: 1160256500

View in Genome Browser
Species Human (GRCh38)
Location 18:77251780-77251802
Sequence GGGCAAACTGCGCACCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256500_1160256511 28 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256500_1160256513 30 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256500_1160256509 5 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256500_1160256512 29 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256512 18:77251832-77251854 TCTGTGAAGCCGCTGCTCCCGGG No data
1160256500_1160256507 4 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160256500 Original CRISPR GGGCAAACTGCGCACCCCGG GGG (reversed) Intronic