ID: 1160256501

View in Genome Browser
Species Human (GRCh38)
Location 18:77251781-77251803
Sequence AGGGCAAACTGCGCACCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256501_1160256509 4 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256501_1160256511 27 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256501_1160256507 3 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256501_1160256512 28 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256512 18:77251832-77251854 TCTGTGAAGCCGCTGCTCCCGGG No data
1160256501_1160256513 29 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160256501 Original CRISPR AGGGCAAACTGCGCACCCCG GGG (reversed) Intronic