ID: 1160256506

View in Genome Browser
Species Human (GRCh38)
Location 18:77251801-77251823
Sequence TGCGCAAAGCCTTCGGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256506_1160256512 8 Left 1160256506 18:77251801-77251823 CCTCGCTCCGAAGGCTTTGCGCA No data
Right 1160256512 18:77251832-77251854 TCTGTGAAGCCGCTGCTCCCGGG No data
1160256506_1160256511 7 Left 1160256506 18:77251801-77251823 CCTCGCTCCGAAGGCTTTGCGCA No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256506_1160256513 9 Left 1160256506 18:77251801-77251823 CCTCGCTCCGAAGGCTTTGCGCA No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160256506 Original CRISPR TGCGCAAAGCCTTCGGAGCG AGG (reversed) Intronic