ID: 1160256507

View in Genome Browser
Species Human (GRCh38)
Location 18:77251807-77251829
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256500_1160256507 4 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256501_1160256507 3 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256497_1160256507 11 Left 1160256497 18:77251773-77251795 CCCCTCTCCCCCGGGGTGCGCAG No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256503_1160256507 1 Left 1160256503 18:77251783-77251805 CCGGGGTGCGCAGTTTGCCCTCG No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256499_1160256507 9 Left 1160256499 18:77251775-77251797 CCTCTCCCCCGGGGTGCGCAGTT No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256498_1160256507 10 Left 1160256498 18:77251774-77251796 CCCTCTCCCCCGGGGTGCGCAGT No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data
1160256502_1160256507 2 Left 1160256502 18:77251782-77251804 CCCGGGGTGCGCAGTTTGCCCTC No data
Right 1160256507 18:77251807-77251829 TCCGAAGGCTTTGCGCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type