ID: 1160256509

View in Genome Browser
Species Human (GRCh38)
Location 18:77251808-77251830
Sequence CCGAAGGCTTTGCGCACACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256501_1160256509 4 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256502_1160256509 3 Left 1160256502 18:77251782-77251804 CCCGGGGTGCGCAGTTTGCCCTC No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256503_1160256509 2 Left 1160256503 18:77251783-77251805 CCGGGGTGCGCAGTTTGCCCTCG No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256500_1160256509 5 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256497_1160256509 12 Left 1160256497 18:77251773-77251795 CCCCTCTCCCCCGGGGTGCGCAG No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256498_1160256509 11 Left 1160256498 18:77251774-77251796 CCCTCTCCCCCGGGGTGCGCAGT No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
1160256499_1160256509 10 Left 1160256499 18:77251775-77251797 CCTCTCCCCCGGGGTGCGCAGTT No data
Right 1160256509 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160256509 Original CRISPR CCGAAGGCTTTGCGCACACC GGG Intronic