ID: 1160256511

View in Genome Browser
Species Human (GRCh38)
Location 18:77251831-77251853
Sequence CTCTGTGAAGCCGCTGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256501_1160256511 27 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256505_1160256511 8 Left 1160256505 18:77251800-77251822 CCCTCGCTCCGAAGGCTTTGCGC No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256508_1160256511 0 Left 1160256508 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256506_1160256511 7 Left 1160256506 18:77251801-77251823 CCTCGCTCCGAAGGCTTTGCGCA No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256503_1160256511 25 Left 1160256503 18:77251783-77251805 CCGGGGTGCGCAGTTTGCCCTCG No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256500_1160256511 28 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data
1160256502_1160256511 26 Left 1160256502 18:77251782-77251804 CCCGGGGTGCGCAGTTTGCCCTC No data
Right 1160256511 18:77251831-77251853 CTCTGTGAAGCCGCTGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160256511 Original CRISPR CTCTGTGAAGCCGCTGCTCC CGG Intronic