ID: 1160256513

View in Genome Browser
Species Human (GRCh38)
Location 18:77251833-77251855
Sequence CTGTGAAGCCGCTGCTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160256506_1160256513 9 Left 1160256506 18:77251801-77251823 CCTCGCTCCGAAGGCTTTGCGCA No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256503_1160256513 27 Left 1160256503 18:77251783-77251805 CCGGGGTGCGCAGTTTGCCCTCG No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256502_1160256513 28 Left 1160256502 18:77251782-77251804 CCCGGGGTGCGCAGTTTGCCCTC No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256501_1160256513 29 Left 1160256501 18:77251781-77251803 CCCCGGGGTGCGCAGTTTGCCCT No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256508_1160256513 2 Left 1160256508 18:77251808-77251830 CCGAAGGCTTTGCGCACACCGGG No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256500_1160256513 30 Left 1160256500 18:77251780-77251802 CCCCCGGGGTGCGCAGTTTGCCC No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data
1160256505_1160256513 10 Left 1160256505 18:77251800-77251822 CCCTCGCTCCGAAGGCTTTGCGC No data
Right 1160256513 18:77251833-77251855 CTGTGAAGCCGCTGCTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160256513 Original CRISPR CTGTGAAGCCGCTGCTCCCG GGG Intronic