ID: 1160257926

View in Genome Browser
Species Human (GRCh38)
Location 18:77263392-77263414
Sequence GTGTTTAAATAGATGAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160257921_1160257926 21 Left 1160257921 18:77263348-77263370 CCTGTAAAACCCGTACTTAGATT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG 0: 1
1: 0
2: 0
3: 16
4: 187
1160257922_1160257926 12 Left 1160257922 18:77263357-77263379 CCCGTACTTAGATTTTTATACCT 0: 1
1: 0
2: 3
3: 40
4: 333
Right 1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG 0: 1
1: 0
2: 0
3: 16
4: 187
1160257920_1160257926 22 Left 1160257920 18:77263347-77263369 CCCTGTAAAACCCGTACTTAGAT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG 0: 1
1: 0
2: 0
3: 16
4: 187
1160257924_1160257926 -8 Left 1160257924 18:77263377-77263399 CCTGAGTTGTTTGTCGTGTTTAA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG 0: 1
1: 0
2: 0
3: 16
4: 187
1160257923_1160257926 11 Left 1160257923 18:77263358-77263380 CCGTACTTAGATTTTTATACCTG 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG 0: 1
1: 0
2: 0
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160257926 Original CRISPR GTGTTTAAATAGATGAGGCA TGG Intronic
904676648 1:32202832-32202854 GTTTTTAAATAGAAGAGGGTTGG + Intronic
904957336 1:34296063-34296085 GTCTTGAAATAGATGGGACATGG + Intergenic
904962546 1:34346040-34346062 GTGTTAAAATATCAGAGGCAAGG + Intergenic
908434586 1:64092548-64092570 GTGGTTGCATAGATCAGGCAGGG + Intronic
908498808 1:64722401-64722423 CTGTTCAAATAGAGGAGGTAAGG + Intergenic
908858924 1:68461124-68461146 GTGTTTTAATATATTACGCAAGG + Intergenic
910308501 1:85795953-85795975 GTGTTTAAAAATATGTGGGATGG + Intronic
913190464 1:116408892-116408914 GTGTTTAAGAAAAGGAGGCAAGG + Intronic
915710651 1:157894982-157895004 GTTTTACAATAGCTGAGGCATGG - Intronic
916264113 1:162873069-162873091 GTTTATAAATAGATAAGGCAGGG - Intergenic
916303200 1:163299021-163299043 GTGTTTGAATTTAAGAGGCAGGG - Intronic
921530041 1:216270868-216270890 GAATTAAAGTAGATGAGGCAAGG - Intronic
921625892 1:217377432-217377454 GTGTGTAAAGAGAAGTGGCATGG + Intergenic
921648508 1:217648368-217648390 CTGTTTAATTAAAGGAGGCAAGG - Intronic
1062832567 10:615696-615718 GTGTTGCCATGGATGAGGCATGG - Intronic
1063042501 10:2357818-2357840 GTGTTTAAAAATCTGAGGCCAGG - Intergenic
1065278683 10:24112939-24112961 ATGTGAAAATAGAGGAGGCAGGG + Intronic
1068104999 10:52603700-52603722 ATGTGTAAATAGATGGGGAATGG + Intergenic
1068683244 10:59842335-59842357 GTGTTTACATAGGCCAGGCACGG - Intronic
1070354599 10:75627436-75627458 GTCTTTAAAGAGATGAGTTATGG + Intronic
1072880283 10:99220192-99220214 GTGTTTAAAGAGATGTTACAGGG + Intronic
1074972342 10:118549530-118549552 CTGTTTAACTAGAAGAGACATGG - Intergenic
1075770009 10:124925787-124925809 GTGTTTCAACAAATGATGCAGGG - Intergenic
1080305184 11:30827726-30827748 GTGTGGAAAGAGAGGAGGCAAGG - Intergenic
1081308486 11:41542353-41542375 GTTTTTACCAAGATGAGGCATGG + Intergenic
1081506784 11:43725813-43725835 GAGTTTGAATAAATGAGGCTAGG + Intronic
1081788274 11:45764067-45764089 GTGCTAAAGAAGATGAGGCAGGG + Intergenic
1082200973 11:49366797-49366819 CTGTTTACATAGATTAGGTAGGG - Intergenic
1082727231 11:56750828-56750850 TTTTTTAAATAAATGAGGCTGGG - Intergenic
1082921639 11:58501399-58501421 TTGTTTAAATAAGTGAGGCTTGG + Intergenic
1084901972 11:72316387-72316409 GATTTCAGATAGATGAGGCAAGG - Intronic
1085468730 11:76742851-76742873 TTTTTTAAATAGATGAGCAAAGG + Intergenic
1086654700 11:89339408-89339430 CTGTTTACATAGATTAGGTAGGG + Intronic
1086845711 11:91747529-91747551 TTGTTTAAATATTTGAGGCCAGG + Intergenic
1087126761 11:94635529-94635551 GTGGTTACATCTATGAGGCAGGG + Intergenic
1088036632 11:105325142-105325164 GTGTTTAAATACATGAACTATGG - Intergenic
1088690252 11:112320650-112320672 TTCTTTAAATAAATGATGCAAGG - Intergenic
1092210186 12:6640688-6640710 GTGAAGAAATAGCTGAGGCAAGG - Intronic
1093246201 12:16740177-16740199 CTGTTAAAAAAGATGAGGTAAGG + Intergenic
1093625492 12:21341927-21341949 GTGTATGTATAAATGAGGCATGG + Intronic
1094433453 12:30395799-30395821 GTTAATAAATTGATGAGGCAAGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1106381743 13:29245990-29246012 ATATTAAAATAGATGAGGCTGGG - Intronic
1107248406 13:38325881-38325903 GTGTTAAAATTGACCAGGCACGG + Intergenic
1107755339 13:43615550-43615572 ATGATTAATTAGATCAGGCATGG - Intronic
1108521195 13:51248378-51248400 GTGGGTAAATAGAAGAGGCATGG - Intronic
1108561526 13:51648849-51648871 GTTTTTAAATAGCTCAGGCCAGG + Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1110328709 13:74246862-74246884 GTGTTAAAAAAGATGAGGGAGGG + Intergenic
1111709091 13:91788737-91788759 GTGTATAAATAGAGGTGGCTGGG + Intronic
1113408707 13:110065018-110065040 ATGTTTAAATAGATAAGTGAAGG - Intergenic
1114760168 14:25305391-25305413 TTATTTAAATAGATGAAGAAAGG + Intergenic
1115679711 14:35722970-35722992 TTGTTTAAATAATTGAGTCAGGG - Intronic
1116089244 14:40283914-40283936 TTGTTTCAATGGAGGAGGCATGG + Intergenic
1118448353 14:65872841-65872863 TTGTTTACATAGATGCAGCAAGG + Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1126602869 15:50446385-50446407 GTGTTTAAATAGTTTAAGCTGGG + Intronic
1126908768 15:53396807-53396829 GTTTTTAAAAATATGAGCCAAGG + Intergenic
1127719440 15:61685422-61685444 GTCTCTAAAAAGATGAGACATGG - Intergenic
1130865876 15:87933033-87933055 GTCTTTGAATACATGAAGCATGG - Exonic
1133563016 16:6967115-6967137 ATGTTTAAATAGATAAGTAATGG - Intronic
1133910831 16:10064919-10064941 GTGTAACAATTGATGAGGCATGG - Intronic
1134888076 16:17812207-17812229 GAGTTTAAATAAATTAGCCAAGG - Intergenic
1138890532 16:61138603-61138625 GTTTTTGAATATATGAGACAAGG - Intergenic
1138929120 16:61630930-61630952 GTGATTAATTGGATGAGGGAAGG + Intergenic
1139047771 16:63083861-63083883 GTGTTAAAATAGGAGAGCCAGGG + Intergenic
1139115331 16:63944292-63944314 TTATTTAAATAGGTGTGGCAGGG - Intergenic
1139284040 16:65795111-65795133 GATTTTAAATAGATAAGGCGTGG + Intergenic
1140094626 16:71864292-71864314 CTGTTTAAAAAGCTGGGGCAGGG - Intronic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1143716060 17:8769954-8769976 GTGTTTAAAGACATGAGGGAAGG + Intergenic
1145833307 17:27935162-27935184 GTGCAAAAATTGATGAGGCAAGG + Intergenic
1146701002 17:34960297-34960319 GTGGAAAAGTAGATGAGGCAGGG - Intronic
1149324257 17:55513694-55513716 GACTTTAAATAGATGACACAAGG + Intergenic
1149954335 17:61031055-61031077 ATGATTAAATAAATGAGGGAAGG + Intronic
1150864801 17:68838399-68838421 GTGTTTATATAAATGAGAGAGGG + Intergenic
1153023452 18:653140-653162 TTGTTTAAATGGATGATGCTGGG - Intronic
1156113841 18:33762038-33762060 GTCTTCTAATAGCTGAGGCAAGG + Intergenic
1157699372 18:49751316-49751338 GGGTTCAAAGAGATGAGACATGG - Intergenic
1157985065 18:52427891-52427913 GTGTTTCAAAAGATGTGCCAAGG - Intronic
1158304120 18:56085783-56085805 GTGTTCAATGAGATGATGCATGG + Intergenic
1159586266 18:70286441-70286463 GAGTTTAAGTAGGTGAGTCATGG + Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1161527235 19:4763985-4764007 GCGTTTACCTAGAAGAGGCAGGG - Intergenic
1163291725 19:16383630-16383652 GTGTTTACACAGATGAGCCTGGG - Intronic
1164483073 19:28630881-28630903 GTGTTTACATATGTGAGACAGGG - Intergenic
1166057897 19:40304339-40304361 GTGTTTAGGTAGATAAGGGAAGG - Intergenic
929011540 2:37450040-37450062 GTGTTTGAAAAAAAGAGGCAGGG + Intergenic
933358663 2:81248906-81248928 TTTTTCAAATGGATGAGGCATGG + Intergenic
933934240 2:87187943-87187965 CTGATTCAATAGATGAGACATGG - Intergenic
934055403 2:88247485-88247507 TTCTTTAAATAGCTGAGGCAGGG - Intergenic
936358902 2:111777952-111777974 CTGATTCAATAGATGAGGCATGG + Intronic
936927901 2:117756476-117756498 ATGTTTACATACATGAGGAATGG - Intergenic
939030060 2:137062955-137062977 GTGTCAAAATCTATGAGGCAAGG - Intronic
939864477 2:147457679-147457701 GTTTTTAAACAGAGGATGCAGGG - Intergenic
940296718 2:152133396-152133418 CTGTTTATATAGATGAGGTAGGG - Exonic
940650700 2:156437237-156437259 TTGTATAAATAGGTGAGGGAAGG + Intronic
941561604 2:167052966-167052988 GTGTTTAAATACATAGGCCAAGG - Intronic
941592530 2:167437642-167437664 CTGTTTGAACAGATGAGCCAGGG - Intergenic
942887161 2:180939674-180939696 GTGAGAAAAGAGATGAGGCATGG - Intergenic
943470637 2:188290978-188291000 GTGTGAAAATAGATGAGAAAAGG - Intergenic
945271767 2:207947970-207947992 GTTTTTAAATACATGAGAAATGG + Intronic
948268037 2:236652217-236652239 GTGTCAAAATTCATGAGGCAAGG - Intergenic
1168732034 20:92789-92811 TTGTTTAAATAAATGGGGCATGG - Intronic
1169730042 20:8776923-8776945 GATTTTAAATAGAGTAGGCACGG + Intronic
1172488234 20:35313079-35313101 TTTTTTAAAAAGATGAGGCCAGG + Intronic
1175095499 20:56538249-56538271 GTGGTTAAAAATATCAGGCAGGG + Intergenic
1176885017 21:14244955-14244977 GTGTGTAAATAAATAAGGCTTGG + Intergenic
1179527085 21:41986551-41986573 GTTTTTAAGTTGATGGGGCAGGG - Intergenic
1180819669 22:18817416-18817438 GTGGTTGAATAGATGTGTCACGG - Intergenic
1181205893 22:21251861-21251883 GTGGTTGAATAGATGTGTCACGG - Intergenic
1181289412 22:21779582-21779604 GTGTATAAATAAATGAGCAAAGG - Intronic
1181735194 22:24876151-24876173 CTGACTCAATAGATGAGGCAGGG - Intronic
1184886943 22:47352252-47352274 GTGTTTCCACAGATGAGGCCAGG - Intergenic
1203221027 22_KI270731v1_random:43552-43574 GTGGTTGAATAGATGTGTCACGG + Intergenic
1203269798 22_KI270734v1_random:43269-43291 GTGGTTGAATAGATGTGTCACGG - Intergenic
953759809 3:45677665-45677687 GATTTGAAATAGGTGAGGCAGGG + Exonic
953810543 3:46109002-46109024 GTGTTTAAAAGCATGAAGCATGG - Intergenic
954623517 3:52009515-52009537 GTATTTAAATAGATTAAACAAGG + Intergenic
956164180 3:66384058-66384080 ATGTGAAAATAGATGACGCAGGG - Exonic
956633644 3:71341471-71341493 ATATTTAAAAAGAAGAGGCAAGG + Intronic
956803024 3:72780061-72780083 TTTTTTAAATAGTAGAGGCAGGG - Intronic
957943683 3:87036747-87036769 GTGTTCCAATGGATGAGACAGGG + Intergenic
959842721 3:110997517-110997539 GTGTTTAAATAGATTTACCAAGG + Intergenic
960363514 3:116743206-116743228 TTGGTTAAATACATGTGGCAAGG - Intronic
963909070 3:150799753-150799775 GTGGTTAAATAGAGGTGGCTGGG - Intergenic
964477802 3:157112192-157112214 CTGTTGAAGGAGATGAGGCAGGG + Intergenic
965891293 3:173517259-173517281 GTGTTAGAATAGAAGATGCATGG + Intronic
966995942 3:185280707-185280729 CTGTTTTAATAGAAGGGGCAGGG + Intronic
967009949 3:185423397-185423419 GTCTTAAAAGAGATGAGGCAGGG + Intronic
975113243 4:70650186-70650208 GTGGTTTAACAGATGAGGAATGG - Intronic
975182094 4:71358017-71358039 GTGTTAAGAGAGATGAGGCCGGG + Intronic
975881671 4:78916165-78916187 GTGCTTAATTAGATATGGCAGGG - Exonic
976986389 4:91304478-91304500 GTGTATAAAATGATGAGTCAAGG - Intronic
977247104 4:94645493-94645515 GTGGTTAAATAGTAGAGCCAGGG + Intronic
977792280 4:101121380-101121402 TTGTTTAAATACATTAAGCAAGG - Intronic
979352079 4:119655810-119655832 GTGATTATACAGAAGAGGCAGGG - Intergenic
982103316 4:151989951-151989973 GTTTTTAAAGAGCTGAGGCGTGG - Intergenic
989977644 5:50605737-50605759 GTGCTTATATAGATAAGCCAAGG + Intergenic
991317673 5:65327755-65327777 GTACTTAAATAGCTGAGGTAAGG - Intronic
992221426 5:74577394-74577416 GTGTTTACTTAGGTGTGGCAAGG + Intergenic
992783234 5:80146753-80146775 CTGTTAAAATAAATGTGGCAGGG - Intronic
995707613 5:115001225-115001247 GTATTGAAATAGAAGAGGCATGG - Intergenic
998865965 5:146502502-146502524 TTATTTAAATAGGTGAGGAAAGG - Intronic
999694900 5:154180082-154180104 CTGTTTAAAAAGGTGAGGCTGGG - Intronic
1001702527 5:173717802-173717824 GTATTTTAATAGATGAGGCTAGG + Intergenic
1001983227 5:176051277-176051299 ATCTTTAAAAAGATCAGGCAAGG + Intronic
1002234238 5:177792775-177792797 ATCTTTAAAAAGATCAGGCAAGG - Intronic
1003869779 6:10392388-10392410 GTGTTTAAAAAAATAAGGAAAGG - Intergenic
1009840760 6:69071031-69071053 ATGGTGAAATACATGAGGCAGGG + Intronic
1009894873 6:69735753-69735775 GTTTTTAAATGGAAAAGGCATGG - Intronic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG + Intergenic
1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG + Intergenic
1016459713 6:144269708-144269730 GGGTTTAAGTATAGGAGGCAGGG - Intergenic
1016668695 6:146674666-146674688 GATTTAAAATAGATGTGGCAAGG + Intronic
1016767604 6:147812274-147812296 GTGTTTATATGGAAGAGGCTCGG + Intergenic
1017483884 6:154884755-154884777 GTATTTTAGTAGATGAGGCCAGG + Intronic
1018016048 6:159713297-159713319 GGGTTTGAAAAGATGAGGCAGGG - Intronic
1019375563 7:689990-690012 GTTTTTAAAGAGCTGAGGGAGGG + Intronic
1020359111 7:7308168-7308190 TTGTTTAAATAGAGGAACCAGGG - Intergenic
1020416991 7:7957879-7957901 GTGTTTAAATATATAAGACTAGG - Intronic
1021022925 7:15626100-15626122 GTGTGTAAATAGAAGTGACATGG + Intronic
1024987351 7:55206810-55206832 GTGCTTGAATAGATGACTCAAGG - Exonic
1027236233 7:76299596-76299618 GTGTTTAGATGGATGAGGTAGGG + Intergenic
1027538830 7:79441983-79442005 GTGTTACAAAAGAAGAGGCAGGG - Intronic
1028021801 7:85785865-85785887 GTATTTGTATAGATGAGGCAGGG + Intergenic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1034396077 7:150825849-150825871 CTATTTACAAAGATGAGGCAGGG - Intronic
1037187623 8:16082720-16082742 GTGTTTAAAGAGGAGATGCAAGG + Intergenic
1040629016 8:49187651-49187673 GTGTTTGAATAGGCGAGGCACGG + Intergenic
1041327257 8:56681674-56681696 GTGTTTAAATGGATCAGGTGGGG - Intergenic
1041694819 8:60724865-60724887 GTGTTGAAATAGATGGCCCAGGG + Intronic
1042663828 8:71184393-71184415 GTGAATAAATAAATGAGGCCGGG + Intergenic
1046684110 8:117205640-117205662 GTTTTAAAATAAATGAGGCCGGG + Intergenic
1047968397 8:130064293-130064315 GGTTTTAAATAGATGTGGAAGGG + Intronic
1048271731 8:133033756-133033778 CTGTTTCAAGAGATGAGGAAAGG - Intronic
1048425935 8:134323526-134323548 GTGCTTAGATAGGTGAGTCATGG - Intergenic
1048460133 8:134614668-134614690 GTGTTCAAAAAGATGAAGCTAGG + Intronic
1049272303 8:141702451-141702473 GTATTTAGAAAGATGACGCAGGG - Intergenic
1051812612 9:21067375-21067397 GTGAGTAAATAGCAGAGGCAAGG - Intergenic
1052556253 9:30021911-30021933 GTTTTTAAAAAGATGAGAGAAGG + Intergenic
1052791260 9:32877354-32877376 GTGTTCTAACAGCTGAGGCATGG + Intergenic
1053569713 9:39291400-39291422 GTGTTTATATATAAGAGCCAAGG - Intergenic
1054091344 9:60850405-60850427 GTGTTTATATATAAGAGCCAAGG - Intergenic
1054112759 9:61125975-61125997 GTGTTTATATATAAGAGCCAAGG - Intergenic
1054127435 9:61327613-61327635 GTGTTTATATATAAGAGCCAAGG + Intergenic
1054338838 9:63835309-63835331 GTGTTCTGATAGATAAGGCAAGG + Intergenic
1055779311 9:79802224-79802246 ATGTATAAATAGAGGAGGAAAGG - Intergenic
1056084858 9:83137161-83137183 GTGTTTAAAGAGATGAAAGAAGG - Intergenic
1059287746 9:113190680-113190702 GTTTTTAAATAGATATGGTAGGG - Intronic
1059874393 9:118618088-118618110 GAGGTTAAATAGGTAAGGCAGGG - Intergenic
1061970564 9:134042628-134042650 GTGTATATATATTTGAGGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189909958 X:45800707-45800729 CTGTTTTAAAAGATGGGGCAGGG + Intergenic
1190738017 X:53268465-53268487 CTGTTTTTATAGATGAGGAATGG - Intronic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1192607873 X:72538484-72538506 GTGTTTAAATATAAGAACCAAGG - Intronic
1193958345 X:87891225-87891247 GTGTTTAAATATATAAGTAAAGG - Intergenic
1194961780 X:100244475-100244497 GTGTTTAAATAGAGGTGAGATGG - Intergenic
1198968722 X:142255371-142255393 TTGTGTTAAGAGATGAGGCAAGG + Intergenic
1199210421 X:145203017-145203039 GTGATTAAAAAGATGATTCATGG + Intergenic