ID: 1160262929

View in Genome Browser
Species Human (GRCh38)
Location 18:77312438-77312460
Sequence ATGCCTTTCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160262927_1160262929 2 Left 1160262927 18:77312413-77312435 CCATGGAAAAAGGACCTCACAAA No data
Right 1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160262929 Original CRISPR ATGCCTTTCTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr