ID: 1160267979

View in Genome Browser
Species Human (GRCh38)
Location 18:77357142-77357164
Sequence CTGGGGATGAGATCCATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160267979_1160267983 23 Left 1160267979 18:77357142-77357164 CCATTAATGGATCTCATCCCCAG No data
Right 1160267983 18:77357188-77357210 TATTCCAAATTTTAAATTACTGG No data
1160267979_1160267984 24 Left 1160267979 18:77357142-77357164 CCATTAATGGATCTCATCCCCAG No data
Right 1160267984 18:77357189-77357211 ATTCCAAATTTTAAATTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160267979 Original CRISPR CTGGGGATGAGATCCATTAA TGG (reversed) Intergenic
No off target data available for this crispr