ID: 1160269241

View in Genome Browser
Species Human (GRCh38)
Location 18:77369082-77369104
Sequence TTAAGGACTTTGTGGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160269241_1160269255 29 Left 1160269241 18:77369082-77369104 CCTTCCCACCACAAAGTCCTTAA No data
Right 1160269255 18:77369134-77369156 ATGGAAGATGATATAATTGAAGG No data
1160269241_1160269248 10 Left 1160269241 18:77369082-77369104 CCTTCCCACCACAAAGTCCTTAA No data
Right 1160269248 18:77369115-77369137 TCTGCCAAGTCCCCCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160269241 Original CRISPR TTAAGGACTTTGTGGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr