ID: 1160269833

View in Genome Browser
Species Human (GRCh38)
Location 18:77373490-77373512
Sequence ATGGGTCCTGGACTTGGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160269833_1160269846 21 Left 1160269833 18:77373490-77373512 CCCCGACCAAGTCCAGGACCCAT No data
Right 1160269846 18:77373534-77373556 CTCACACCCCGAGCAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160269833 Original CRISPR ATGGGTCCTGGACTTGGTCG GGG (reversed) Intergenic
No off target data available for this crispr