ID: 1160276788

View in Genome Browser
Species Human (GRCh38)
Location 18:77444509-77444531
Sequence CCGCGATGGCTATACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160276788_1160276795 -7 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276795 18:77444525-77444547 ATCGCGGGCATGGAGGGCTGTGG No data
1160276788_1160276799 12 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276799 18:77444544-77444566 GTGGTCAGGAGCTTCGCCAGGGG No data
1160276788_1160276797 10 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276797 18:77444542-77444564 CTGTGGTCAGGAGCTTCGCCAGG No data
1160276788_1160276796 -2 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276796 18:77444530-77444552 GGGCATGGAGGGCTGTGGTCAGG No data
1160276788_1160276800 15 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276800 18:77444547-77444569 GTCAGGAGCTTCGCCAGGGGAGG No data
1160276788_1160276798 11 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276798 18:77444543-77444565 TGTGGTCAGGAGCTTCGCCAGGG No data
1160276788_1160276801 16 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276801 18:77444548-77444570 TCAGGAGCTTCGCCAGGGGAGGG No data
1160276788_1160276802 24 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276802 18:77444556-77444578 TTCGCCAGGGGAGGGCACGCTGG No data
1160276788_1160276803 25 Left 1160276788 18:77444509-77444531 CCTGCACAGTATAGCCATCGCGG No data
Right 1160276803 18:77444557-77444579 TCGCCAGGGGAGGGCACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160276788 Original CRISPR CCGCGATGGCTATACTGTGC AGG (reversed) Intergenic