ID: 1160278804

View in Genome Browser
Species Human (GRCh38)
Location 18:77466887-77466909
Sequence CAGAAGAAGGAAGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160278804_1160278810 17 Left 1160278804 18:77466887-77466909 CCCTCCTCCTCTTCCTTCTTCTG No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160278804 Original CRISPR CAGAAGAAGGAAGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr