ID: 1160278810

View in Genome Browser
Species Human (GRCh38)
Location 18:77466927-77466949
Sequence GCTCCATTATCATTTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160278807_1160278810 10 Left 1160278807 18:77466894-77466916 CCTCTTCCTTCTTCTGCTTATTA No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data
1160278804_1160278810 17 Left 1160278804 18:77466887-77466909 CCCTCCTCCTCTTCCTTCTTCTG No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data
1160278805_1160278810 16 Left 1160278805 18:77466888-77466910 CCTCCTCCTCTTCCTTCTTCTGC 0: 4
1: 46
2: 653
3: 3155
4: 10831
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data
1160278806_1160278810 13 Left 1160278806 18:77466891-77466913 CCTCCTCTTCCTTCTTCTGCTTA No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data
1160278802_1160278810 28 Left 1160278802 18:77466876-77466898 CCTCTTCCTCTCCCTCCTCCTCT No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data
1160278803_1160278810 22 Left 1160278803 18:77466882-77466904 CCTCTCCCTCCTCCTCTTCCTTC No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data
1160278808_1160278810 4 Left 1160278808 18:77466900-77466922 CCTTCTTCTGCTTATTATTGTCC No data
Right 1160278810 18:77466927-77466949 GCTCCATTATCATTTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160278810 Original CRISPR GCTCCATTATCATTTGTTAC AGG Intergenic
No off target data available for this crispr