ID: 1160293274

View in Genome Browser
Species Human (GRCh38)
Location 18:77614928-77614950
Sequence CGTATGTTAGCTGTGTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160293274_1160293277 21 Left 1160293274 18:77614928-77614950 CCAGAAGACACAGCTAACATACG No data
Right 1160293277 18:77614972-77614994 AGCATTCAGGAGACATTACTTGG No data
1160293274_1160293275 -8 Left 1160293274 18:77614928-77614950 CCAGAAGACACAGCTAACATACG No data
Right 1160293275 18:77614943-77614965 AACATACGTCTTTTAAAGATTGG No data
1160293274_1160293276 8 Left 1160293274 18:77614928-77614950 CCAGAAGACACAGCTAACATACG No data
Right 1160293276 18:77614959-77614981 AGATTGGTGCTTTAGCATTCAGG No data
1160293274_1160293278 22 Left 1160293274 18:77614928-77614950 CCAGAAGACACAGCTAACATACG No data
Right 1160293278 18:77614973-77614995 GCATTCAGGAGACATTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160293274 Original CRISPR CGTATGTTAGCTGTGTCTTC TGG (reversed) Intergenic
No off target data available for this crispr