ID: 1160294236

View in Genome Browser
Species Human (GRCh38)
Location 18:77622888-77622910
Sequence TCCACGGCTCTGCTCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160294233_1160294236 -1 Left 1160294233 18:77622866-77622888 CCTCTGGATATGTAGGGCCGAGT 0: 1
1: 0
2: 1
3: 17
4: 178
Right 1160294236 18:77622888-77622910 TCCACGGCTCTGCTCACACTTGG 0: 1
1: 0
2: 0
3: 12
4: 152
1160294228_1160294236 19 Left 1160294228 18:77622846-77622868 CCCTCTAAACAGTAAAGGGTCCT 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1160294236 18:77622888-77622910 TCCACGGCTCTGCTCACACTTGG 0: 1
1: 0
2: 0
3: 12
4: 152
1160294229_1160294236 18 Left 1160294229 18:77622847-77622869 CCTCTAAACAGTAAAGGGTCCTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1160294236 18:77622888-77622910 TCCACGGCTCTGCTCACACTTGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160294236 Original CRISPR TCCACGGCTCTGCTCACACT TGG Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900418199 1:2544637-2544659 TCCAGGGCTGAGATCACACTTGG - Intergenic
902183595 1:14708637-14708659 CCCACAGCTCTGCTTACACATGG + Intronic
905088018 1:35401273-35401295 TCCATGACTTTGCTAACACTTGG + Intronic
905522121 1:38608340-38608362 ACCAGGGCTGTGCTCACGCTGGG + Intergenic
907229618 1:52984230-52984252 TCCAGGGCTGTGCTCAACCTTGG + Intronic
907865332 1:58394215-58394237 TCCACATCTCTGCCAACACTTGG - Intronic
909820277 1:80052292-80052314 TCGACTGCTTTGTTCACACTCGG - Intergenic
914403174 1:147343148-147343170 TCCATGCTTCAGCTCACACTCGG - Intergenic
916542301 1:165768681-165768703 TGCACGGCTCTGCTCGCAGAGGG - Exonic
919968747 1:202556771-202556793 TACAGGGCTCTGCACACAGTGGG + Intronic
920161444 1:204001404-204001426 TCCACAGCTCTGCACCCACAGGG - Intergenic
922345652 1:224694167-224694189 TCCAGGGCTCAGCTCATCCTGGG - Intronic
922999373 1:229994120-229994142 TACAGGGCTCTGCTCACGCCAGG - Intergenic
1066415198 10:35214979-35215001 TCCACAGCTCTCCCCACACCCGG + Intergenic
1066546865 10:36509477-36509499 TGCAAGGTTCTGCTCACATTAGG + Intergenic
1066697182 10:38089680-38089702 TCCATGGCTCTGCTGAAAATAGG - Intergenic
1071328610 10:84540364-84540386 CCCACGGCTTTGCTCTCCCTTGG - Intergenic
1071920578 10:90345516-90345538 TCCAGGGCACTGAGCACACTGGG + Intergenic
1071976935 10:90964685-90964707 CCCACGGCTCAGCTACCACTGGG + Intergenic
1073085092 10:100883254-100883276 CCCACAGCTCTGCCCTCACTGGG + Intergenic
1073347543 10:102795416-102795438 TCCACTGTTCTGCTCTCCCTGGG + Intronic
1073526903 10:104191502-104191524 TCCACTCCTCTCCTCACACTTGG + Intronic
1073649407 10:105342735-105342757 TCCACAGCACTGGTCACACATGG + Intergenic
1073770615 10:106731352-106731374 TCCACGACCCTGCACAGACTGGG + Intronic
1074051927 10:109888063-109888085 TGCAAGCCTCTCCTCACACTGGG - Exonic
1074577592 10:114684996-114685018 TCCACGGCTCGTCTCATACCAGG - Intronic
1074891395 10:117739215-117739237 TCCAAGGTGTTGCTCACACTGGG - Intergenic
1075467492 10:122662468-122662490 TCCATGCCATTGCTCACACTGGG + Intergenic
1076639671 10:131905762-131905784 TCCACGGCTCTGCGGCCAGTCGG - Intronic
1081656036 11:44858242-44858264 TCCACGCCTATGCTCACCCTGGG + Intronic
1084663239 11:70559536-70559558 GGCACGGCACTCCTCACACTGGG + Intronic
1084955128 11:72687137-72687159 ACCACAGCACTGATCACACTGGG + Intronic
1089640404 11:119844069-119844091 TCCACGGGCCTGCTCATTCTGGG - Intergenic
1089764174 11:120751081-120751103 TCTACTGCGCTTCTCACACTGGG - Intronic
1090472247 11:126990498-126990520 TCCCGGGCTCTGCTCTCTCTGGG + Intronic
1091182829 11:133622283-133622305 TCCTCTGCTCTGCCCTCACTCGG + Intergenic
1094774189 12:33704004-33704026 TCCACAGCTTTGCCAACACTGGG + Intergenic
1098045104 12:66392352-66392374 TCCACAGCACTGTCCACACTGGG + Exonic
1104547267 12:129723596-129723618 TCCATGGCTCTGTCCTCACTGGG + Intronic
1105648338 13:22346132-22346154 TCTTCTGCGCTGCTCACACTGGG - Intergenic
1106775672 13:33006633-33006655 TAGACAGCTCTGCTGACACTTGG + Intergenic
1108636336 13:52338788-52338810 TCCACATCCCGGCTCACACTTGG + Intergenic
1109755666 13:66756145-66756167 TTCACTGCTTTGCTCACAATAGG - Intronic
1110552252 13:76823033-76823055 TCCAGGGCTCAGCTCCCACAAGG + Intergenic
1112964077 13:105165471-105165493 TCCACATCTCTGCCAACACTTGG - Intergenic
1113834884 13:113322238-113322260 GTCAGGGCTCTGCTCACACAGGG - Intronic
1115982193 14:39065645-39065667 TCTATGCCTCTCCTCACACTGGG + Intronic
1117891614 14:60427556-60427578 TCTTCTGCTTTGCTCACACTGGG + Intronic
1119415327 14:74465846-74465868 CCCACTGCTCTGCTGACCCTAGG - Intergenic
1120578935 14:86221976-86221998 GCAACGGCTCTGCTCTCTCTGGG + Intergenic
1122276934 14:100595812-100595834 TCCACATCTTTGCTGACACTTGG + Intergenic
1122594860 14:102883139-102883161 TCTGCGGCTCTGGTCACACCTGG - Intronic
1122633019 14:103116310-103116332 TCCACGCCTCAGCCCACAGTGGG + Intergenic
1124079428 15:26477653-26477675 TGCACCCCTCTGCCCACACTTGG + Intergenic
1127322384 15:57859452-57859474 TCTACTGCTGTGCCCACACTAGG - Intergenic
1127350124 15:58142902-58142924 TCCAGGGCACTGCTGACAGTAGG - Intronic
1128363687 15:66981895-66981917 TCCCTGGCTCTGCTCACTCACGG + Intergenic
1129713875 15:77835943-77835965 TCCAAGCCTTTGCTCACACAGGG + Intergenic
1141821083 16:86446339-86446361 GCCACGGCTCTGCCCAGAGTAGG + Intergenic
1142122438 16:88393533-88393555 TCCTGGGCTCTGCCCACCCTGGG - Intergenic
1142619129 17:1154004-1154026 CACATGGCTCTGCTCCCACTCGG + Intronic
1143105406 17:4527744-4527766 CCCACAGCTTTGATCACACTTGG - Intronic
1144005385 17:11094894-11094916 TCCCCTGCTCTGCTCCCACTGGG + Intergenic
1152246815 17:79188915-79188937 TCCCAGGCTCTGCTCAGCCTAGG - Intronic
1154339761 18:13493222-13493244 TCCACAAGTCTGCTCATACTGGG + Intronic
1159530546 18:69650390-69650412 TCTAGGGCTTTGCTCACTCTTGG - Intronic
1160294236 18:77622888-77622910 TCCACGGCTCTGCTCACACTTGG + Intergenic
1162782970 19:13016618-13016640 TCCATGGCTCTGTTCAAATTGGG + Intronic
1163987956 19:20970719-20970741 GCCAGGGCTCTGCCCACAGTAGG + Intergenic
1164459875 19:28437595-28437617 TCTAAGGTTCAGCTCACACTGGG - Intergenic
1164789178 19:30961522-30961544 CCCAGGGCTCTACCCACACTGGG - Intergenic
1167037142 19:47001204-47001226 GCCACGGCTCTGCCACCACTAGG + Exonic
1167701571 19:51050613-51050635 TCCACATCTCTGCTAATACTTGG + Intergenic
1167716107 19:51143705-51143727 CCCACTTCTCTGCTCACACAAGG + Intronic
1167723976 19:51198808-51198830 TCCCCTTCTCTGCTCACACAGGG + Intergenic
1168180982 19:54663046-54663068 TTCACGGCTCTGCTCTGCCTCGG + Exonic
926060092 2:9799875-9799897 TCTGCCGCGCTGCTCACACTCGG - Intergenic
926304490 2:11628143-11628165 AACACAGCTCTGCCCACACTGGG - Intronic
930075761 2:47404202-47404224 TCCACAACTCTGCTCCCCCTAGG - Intronic
934618529 2:95790101-95790123 TTCCCGGCTCTGCTCAAACATGG - Intergenic
934642364 2:96034458-96034480 TTCCCGGCTCTGCTCAAACATGG + Intronic
937865577 2:126748968-126748990 TCCACAGCCGTGCTCACTCTGGG + Intergenic
939243201 2:139589344-139589366 TCCAAGTCTTTGCTCACACATGG + Intergenic
939744528 2:145952273-145952295 TCTTCTGCTTTGCTCACACTGGG + Intergenic
947099741 2:226607227-226607249 TCGAAGGCTCTGCTCTCTCTGGG + Intergenic
947532525 2:230921753-230921775 TGCACAGCTCTGATCACCCTAGG + Intronic
948845907 2:240682743-240682765 TCCAAGGCCCTGCTCCCAGTGGG - Exonic
948847951 2:240691986-240692008 TCCAAGGCCCTGCTCCCAGTGGG + Exonic
948981635 2:241497705-241497727 TGCACTGCCCTGCTCACCCTGGG - Intronic
1168930919 20:1623291-1623313 TCCACGGTTCTTCTCATACTTGG + Intergenic
1169282260 20:4277950-4277972 TCCAGGGCTCTTTCCACACTGGG + Intergenic
1170434833 20:16315639-16315661 TCCACTGCTCTGCTGACCCTGGG - Intronic
1171798090 20:29582001-29582023 TCCACAGCTCAGCTTACATTTGG - Intergenic
1173431196 20:42988418-42988440 TCCACGGGTCTGCTCTCTCAGGG + Intronic
1174560797 20:51429300-51429322 TCCAAGGCTCTGCCCACCCCAGG - Intronic
1174746520 20:53068560-53068582 TCCATGGCACTGACCACACTTGG + Intronic
1175146659 20:56901637-56901659 AGCACAGCCCTGCTCACACTGGG + Intergenic
1175467683 20:59202825-59202847 TCCAGGGCGCAGCTCTCACTTGG + Intronic
1179893853 21:44350746-44350768 CCCGCGCCTCTGCGCACACTGGG - Intronic
1181348947 22:22241705-22241727 TCCACCCCTCTGCTCTCACATGG - Intergenic
1184458080 22:44622699-44622721 TCCACAGCCCTGCTCCCCCTTGG + Intergenic
1184746447 22:46458818-46458840 TCCTGGGCTCTGCTCTCACTCGG - Intronic
950491022 3:13305199-13305221 TCAACCTCACTGCTCACACTGGG - Intergenic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
950667645 3:14506845-14506867 TCCACAGCACTGTCCACACTGGG + Exonic
954337828 3:49929948-49929970 CCCACGGCTCTGCTGGGACTAGG - Exonic
954619804 3:51989061-51989083 TCCAGGGCTCAGCTGTCACTGGG - Exonic
954683342 3:52357792-52357814 TCCAGGGCCCTGCTCAGGCTAGG + Intronic
960168735 3:114433962-114433984 TCCACAGCTCCTCTCACACTGGG + Intronic
960522537 3:118671829-118671851 TCCTGGGCTCTCCTCAGACTAGG - Intergenic
968752149 4:2395859-2395881 CCCAAGGCACTGCTGACACTTGG + Intronic
968943055 4:3649112-3649134 ACCACGGCCCTGTTCACACTGGG - Intergenic
975448601 4:74498791-74498813 TCCATATCTCTCCTCACACTTGG + Intergenic
975633856 4:76426424-76426446 TTCAAGGTTCTGCTCACACCTGG - Intergenic
981665049 4:147215039-147215061 TCCACTGGTCTGCTACCACTGGG - Intergenic
983586025 4:169355520-169355542 TCCACATCTCTGCCAACACTTGG - Intergenic
983916733 4:173300592-173300614 TTCACGGCTCTGCTCCCACCGGG - Intronic
994459181 5:100051781-100051803 TCCACAACCCTACTCACACTAGG - Intergenic
995949893 5:117698538-117698560 TCCATTACTCTGCTCACATTTGG + Intergenic
997641087 5:135449407-135449429 TCCACGGCCCTTCCCAGACTTGG - Exonic
998607602 5:143650794-143650816 CCCACAGATCTGCTGACACTTGG + Intergenic
1002183790 5:177444579-177444601 TCCACAGTGCTGATCACACTGGG - Intergenic
1004429456 6:15530678-15530700 TCCACGGCTCTCCCTACAATGGG + Intronic
1007073862 6:39054535-39054557 TCCACAGCTCTGCTCAGAGTAGG + Intronic
1007495801 6:42259680-42259702 TCCTCGGCTTTGGGCACACTCGG + Exonic
1007692069 6:43708918-43708940 TGCATGGCTCTGCTCATATTGGG + Intergenic
1007745770 6:44042230-44042252 TCCACAGCTCTGCTCACTGAGGG - Intergenic
1010244687 6:73652382-73652404 TCCACATCTCTGCTAACATTTGG + Intronic
1013253625 6:108360646-108360668 TCTCTGGCTCTGCTAACACTGGG - Intronic
1015434845 6:133173458-133173480 CTCACTGCTCTGCTCACCCTTGG + Intergenic
1019541582 7:1554072-1554094 TCCGCGGCTCTGCACACTCCAGG + Intronic
1020586913 7:10079850-10079872 TTCACTGCTCTGCTCTCCCTTGG + Intergenic
1028640910 7:93040600-93040622 CTCACCGCTCTGCTCACCCTTGG + Intergenic
1029167791 7:98606633-98606655 TCCACATCTTTGCTAACACTTGG + Intergenic
1029392720 7:100286332-100286354 TCTCCAGGTCTGCTCACACTTGG - Intergenic
1035048274 7:155983354-155983376 TCCCCAGCTCTGCCCACCCTGGG - Intergenic
1035719365 8:1780096-1780118 CCCAGGGCTCTGCTCTCATTGGG - Intronic
1039585819 8:38706147-38706169 TGCAGGGCTCTGATCACCCTGGG + Intergenic
1040349325 8:46547961-46547983 TCCACATCTTTGCTAACACTTGG + Intergenic
1043909420 8:85843516-85843538 TCCAGGGCTCTGCTGACTCATGG + Intergenic
1047959246 8:129999000-129999022 TCCTCAGCTCAGCTCAAACTTGG + Intronic
1048035456 8:130673351-130673373 ACCACCGCTCTGCTCACATGTGG + Intergenic
1048469563 8:134695253-134695275 GCCTCGGCTCTGCTCCCAGTAGG + Intronic
1049197760 8:141324921-141324943 TCCAGGACTCTGCCCACAGTGGG + Intergenic
1049318147 8:141980633-141980655 TCTGTGGCTCTGCCCACACTTGG + Intergenic
1053136055 9:35650753-35650775 TGCACGGATCTACTCGCACTGGG - Exonic
1053480809 9:38414944-38414966 GCATCTGCTCTGCTCACACTGGG + Intronic
1055785459 9:79865072-79865094 GCCACGGCTCCACTCACATTGGG + Intergenic
1055785559 9:79865814-79865836 GCCACTGCTCAGCTCACATTGGG + Intergenic
1057548860 9:96037640-96037662 TCCCTGGCCCTGCTCCCACTTGG - Intergenic
1058651773 9:107181690-107181712 TCCAGGCCTCTCCTTACACTGGG - Intergenic
1188588609 X:31806703-31806725 TCCATGGCCTTGCTCACACTGGG + Intronic
1188728240 X:33611478-33611500 TCCAAAGCTCAGCTCTCACTAGG - Intergenic
1189963152 X:46344391-46344413 TGCTGGGCTCTGCTAACACTTGG - Intergenic
1192236120 X:69297231-69297253 ACCACTGCTCTGGTCTCACTGGG + Intergenic
1197761534 X:130031442-130031464 TCCAGGGCTCTGCACACAGCTGG + Intronic
1198519705 X:137440542-137440564 ACCAAGGCATTGCTCACACTGGG + Intergenic
1199697609 X:150354048-150354070 TCCAATGCTCTGCACACAGTAGG + Intergenic
1199846994 X:151698832-151698854 TCCACGGCTCTGCCCAGGCCTGG - Intronic
1200902051 Y:8442613-8442635 TTCATGGCTCTGCTTACAATGGG - Intergenic
1201240762 Y:11954872-11954894 TCCATGGCTCAGATCACTCTAGG - Intergenic
1201567434 Y:15381628-15381650 CCCACAGCTGTGCTCACACCAGG - Intergenic
1202304554 Y:23454725-23454747 TACAGGGCTCTGCACACAGTGGG + Intergenic
1202566256 Y:26215866-26215888 TACAGGGCTCTGCACACAGTGGG - Intergenic