ID: 1160296741

View in Genome Browser
Species Human (GRCh38)
Location 18:77645344-77645366
Sequence GTGTTATCACACATGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160296741_1160296742 6 Left 1160296741 18:77645344-77645366 CCTGCTAGCATGTGTGATAACAC No data
Right 1160296742 18:77645373-77645395 TCCCCACCCCATAGTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160296741 Original CRISPR GTGTTATCACACATGCTAGC AGG (reversed) Intergenic