ID: 1160301457

View in Genome Browser
Species Human (GRCh38)
Location 18:77684544-77684566
Sequence CAGACTAGACAGAGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160301454_1160301457 -8 Left 1160301454 18:77684529-77684551 CCATTCTATTGGGAGCAGACTAG No data
Right 1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG No data
1160301450_1160301457 21 Left 1160301450 18:77684500-77684522 CCTCGTATGCTTGAGAAATGGAA No data
Right 1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160301457 Original CRISPR CAGACTAGACAGAGGGAGCA AGG Intergenic
No off target data available for this crispr