ID: 1160301969

View in Genome Browser
Species Human (GRCh38)
Location 18:77690193-77690215
Sequence TGGTGTCTGAATAAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160301969_1160301973 18 Left 1160301969 18:77690193-77690215 CCGTTCTCCTTATTCAGACACCA No data
Right 1160301973 18:77690234-77690256 TTTCTTGGTCAACTTGATTCTGG No data
1160301969_1160301975 30 Left 1160301969 18:77690193-77690215 CCGTTCTCCTTATTCAGACACCA No data
Right 1160301975 18:77690246-77690268 CTTGATTCTGGCCAAGGCAGAGG No data
1160301969_1160301974 24 Left 1160301969 18:77690193-77690215 CCGTTCTCCTTATTCAGACACCA No data
Right 1160301974 18:77690240-77690262 GGTCAACTTGATTCTGGCCAAGG No data
1160301969_1160301972 3 Left 1160301969 18:77690193-77690215 CCGTTCTCCTTATTCAGACACCA No data
Right 1160301972 18:77690219-77690241 ATCGATTGCTTTCTTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160301969 Original CRISPR TGGTGTCTGAATAAGGAGAA CGG (reversed) Intergenic
No off target data available for this crispr