ID: 1160302707 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:77700216-77700238 |
| Sequence | GATGCCAGACTGTGTCATGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160302705_1160302707 | 0 | Left | 1160302705 | 18:77700193-77700215 | CCAGCGCAGGGGAGCTGTGGGTG | No data | ||
| Right | 1160302707 | 18:77700216-77700238 | GATGCCAGACTGTGTCATGCTGG | No data | ||||
| 1160302702_1160302707 | 7 | Left | 1160302702 | 18:77700186-77700208 | CCGTGGTCCAGCGCAGGGGAGCT | No data | ||
| Right | 1160302707 | 18:77700216-77700238 | GATGCCAGACTGTGTCATGCTGG | No data | ||||
| 1160302701_1160302707 | 10 | Left | 1160302701 | 18:77700183-77700205 | CCTCCGTGGTCCAGCGCAGGGGA | No data | ||
| Right | 1160302707 | 18:77700216-77700238 | GATGCCAGACTGTGTCATGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160302707 | Original CRISPR | GATGCCAGACTGTGTCATGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||