ID: 1160302707

View in Genome Browser
Species Human (GRCh38)
Location 18:77700216-77700238
Sequence GATGCCAGACTGTGTCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160302705_1160302707 0 Left 1160302705 18:77700193-77700215 CCAGCGCAGGGGAGCTGTGGGTG No data
Right 1160302707 18:77700216-77700238 GATGCCAGACTGTGTCATGCTGG No data
1160302702_1160302707 7 Left 1160302702 18:77700186-77700208 CCGTGGTCCAGCGCAGGGGAGCT No data
Right 1160302707 18:77700216-77700238 GATGCCAGACTGTGTCATGCTGG No data
1160302701_1160302707 10 Left 1160302701 18:77700183-77700205 CCTCCGTGGTCCAGCGCAGGGGA No data
Right 1160302707 18:77700216-77700238 GATGCCAGACTGTGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160302707 Original CRISPR GATGCCAGACTGTGTCATGC TGG Intergenic
No off target data available for this crispr