ID: 1160302709

View in Genome Browser
Species Human (GRCh38)
Location 18:77700241-77700263
Sequence TCATGCTACTGCCTTTGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160302708_1160302709 -2 Left 1160302708 18:77700220-77700242 CCAGACTGTGTCATGCTGGTGTC No data
Right 1160302709 18:77700241-77700263 TCATGCTACTGCCTTTGTGCCGG No data
1160302705_1160302709 25 Left 1160302705 18:77700193-77700215 CCAGCGCAGGGGAGCTGTGGGTG No data
Right 1160302709 18:77700241-77700263 TCATGCTACTGCCTTTGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160302709 Original CRISPR TCATGCTACTGCCTTTGTGC CGG Intergenic
No off target data available for this crispr