ID: 1160302710

View in Genome Browser
Species Human (GRCh38)
Location 18:77700244-77700266
Sequence TGCTACTGCCTTTGTGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160302708_1160302710 1 Left 1160302708 18:77700220-77700242 CCAGACTGTGTCATGCTGGTGTC No data
Right 1160302710 18:77700244-77700266 TGCTACTGCCTTTGTGCCGGAGG No data
1160302705_1160302710 28 Left 1160302705 18:77700193-77700215 CCAGCGCAGGGGAGCTGTGGGTG No data
Right 1160302710 18:77700244-77700266 TGCTACTGCCTTTGTGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160302710 Original CRISPR TGCTACTGCCTTTGTGCCGG AGG Intergenic
No off target data available for this crispr