ID: 1160303235

View in Genome Browser
Species Human (GRCh38)
Location 18:77705437-77705459
Sequence AATTCAAATGCTAACTTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160303235_1160303236 -9 Left 1160303235 18:77705437-77705459 CCTACTAAGTTAGCATTTGAATT No data
Right 1160303236 18:77705451-77705473 ATTTGAATTGCTAGACTGAGTGG No data
1160303235_1160303238 17 Left 1160303235 18:77705437-77705459 CCTACTAAGTTAGCATTTGAATT No data
Right 1160303238 18:77705477-77705499 AGTTTCACCCTCACCCATGTGGG No data
1160303235_1160303237 16 Left 1160303235 18:77705437-77705459 CCTACTAAGTTAGCATTTGAATT No data
Right 1160303237 18:77705476-77705498 AAGTTTCACCCTCACCCATGTGG No data
1160303235_1160303239 20 Left 1160303235 18:77705437-77705459 CCTACTAAGTTAGCATTTGAATT No data
Right 1160303239 18:77705480-77705502 TTCACCCTCACCCATGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160303235 Original CRISPR AATTCAAATGCTAACTTAGT AGG (reversed) Intergenic
No off target data available for this crispr