ID: 1160303237

View in Genome Browser
Species Human (GRCh38)
Location 18:77705476-77705498
Sequence AAGTTTCACCCTCACCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160303235_1160303237 16 Left 1160303235 18:77705437-77705459 CCTACTAAGTTAGCATTTGAATT No data
Right 1160303237 18:77705476-77705498 AAGTTTCACCCTCACCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160303237 Original CRISPR AAGTTTCACCCTCACCCATG TGG Intergenic
No off target data available for this crispr