ID: 1160305866

View in Genome Browser
Species Human (GRCh38)
Location 18:77735714-77735736
Sequence TCCCCTAACAAAAAAACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160305866_1160305869 2 Left 1160305866 18:77735714-77735736 CCATAAGTTTTTTTGTTAGGGGA No data
Right 1160305869 18:77735739-77735761 GATAGAATTCACTGTTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160305866 Original CRISPR TCCCCTAACAAAAAAACTTA TGG (reversed) Intergenic
No off target data available for this crispr