ID: 1160313877

View in Genome Browser
Species Human (GRCh38)
Location 18:77822204-77822226
Sequence TCACTGAAGCTGCCACAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160313877_1160313883 11 Left 1160313877 18:77822204-77822226 CCCGTCTGTGGCAGCTTCAGTGA No data
Right 1160313883 18:77822238-77822260 ACCACAGCCCCACATTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160313877 Original CRISPR TCACTGAAGCTGCCACAGAC GGG (reversed) Intergenic
No off target data available for this crispr