ID: 1160315881

View in Genome Browser
Species Human (GRCh38)
Location 18:77846741-77846763
Sequence TTGGAAAAGCTTGAGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160315876_1160315881 20 Left 1160315876 18:77846698-77846720 CCTCATAGAATGACTTAAAAACA No data
Right 1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG No data
1160315879_1160315881 -10 Left 1160315879 18:77846728-77846750 CCACTTCTCATTTTTGGAAAAGC No data
Right 1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG No data
1160315878_1160315881 -6 Left 1160315878 18:77846724-77846746 CCTTCCACTTCTCATTTTTGGAA No data
Right 1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160315881 Original CRISPR TTGGAAAAGCTTGAGAAGGA TGG Intergenic
No off target data available for this crispr