ID: 1160318415

View in Genome Browser
Species Human (GRCh38)
Location 18:77868689-77868711
Sequence CTGACTACAAGGCTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160318408_1160318415 -1 Left 1160318408 18:77868667-77868689 CCAGAGACTCAATAGGCCACTGC No data
Right 1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160318415 Original CRISPR CTGACTACAAGGCTGGGGGA AGG Intergenic
No off target data available for this crispr