ID: 1160322053

View in Genome Browser
Species Human (GRCh38)
Location 18:77905505-77905527
Sequence ATGGACAGGTGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160322044_1160322053 2 Left 1160322044 18:77905480-77905502 CCTTGCAGAGGCCACGGACGCCT No data
Right 1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG No data
1160322047_1160322053 -9 Left 1160322047 18:77905491-77905513 CCACGGACGCCTGGATGGACAGG No data
Right 1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG No data
1160322043_1160322053 5 Left 1160322043 18:77905477-77905499 CCGCCTTGCAGAGGCCACGGACG No data
Right 1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160322053 Original CRISPR ATGGACAGGTGGAAGGTGGA AGG Intergenic
No off target data available for this crispr