ID: 1160327884

View in Genome Browser
Species Human (GRCh38)
Location 18:77967455-77967477
Sequence GTCCAAGCTCGTGGTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160327884_1160327887 -10 Left 1160327884 18:77967455-77967477 CCCACAGCACCACGAGCTTGGAC No data
Right 1160327887 18:77967468-77967490 GAGCTTGGACTTTCAGCCTTCGG No data
1160327884_1160327891 18 Left 1160327884 18:77967455-77967477 CCCACAGCACCACGAGCTTGGAC No data
Right 1160327891 18:77967496-77967518 AGAAAATAAATTTGTTTGGGAGG No data
1160327884_1160327890 15 Left 1160327884 18:77967455-77967477 CCCACAGCACCACGAGCTTGGAC No data
Right 1160327890 18:77967493-77967515 CTGAGAAAATAAATTTGTTTGGG No data
1160327884_1160327889 14 Left 1160327884 18:77967455-77967477 CCCACAGCACCACGAGCTTGGAC No data
Right 1160327889 18:77967492-77967514 ACTGAGAAAATAAATTTGTTTGG No data
1160327884_1160327893 28 Left 1160327884 18:77967455-77967477 CCCACAGCACCACGAGCTTGGAC No data
Right 1160327893 18:77967506-77967528 TTTGTTTGGGAGGCTGAGGCAGG No data
1160327884_1160327892 24 Left 1160327884 18:77967455-77967477 CCCACAGCACCACGAGCTTGGAC No data
Right 1160327892 18:77967502-77967524 TAAATTTGTTTGGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160327884 Original CRISPR GTCCAAGCTCGTGGTGCTGT GGG (reversed) Intergenic