ID: 1160335207

View in Genome Browser
Species Human (GRCh38)
Location 18:78032705-78032727
Sequence CGCCTGCCTGATTATGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160335202_1160335207 -2 Left 1160335202 18:78032684-78032706 CCTGATTCCCAAAGCAAAGCACG No data
Right 1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG No data
1160335201_1160335207 -1 Left 1160335201 18:78032683-78032705 CCCTGATTCCCAAAGCAAAGCAC No data
Right 1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG No data
1160335204_1160335207 -10 Left 1160335204 18:78032692-78032714 CCAAAGCAAAGCACGCCTGCCTG No data
Right 1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG No data
1160335203_1160335207 -9 Left 1160335203 18:78032691-78032713 CCCAAAGCAAAGCACGCCTGCCT No data
Right 1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160335207 Original CRISPR CGCCTGCCTGATTATGAGGC GGG Intergenic
No off target data available for this crispr