ID: 1160337678

View in Genome Browser
Species Human (GRCh38)
Location 18:78057249-78057271
Sequence CAGAAAAAGGAGAGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160337674_1160337678 18 Left 1160337674 18:78057208-78057230 CCTATATTGCTGTGAACATAAAG No data
Right 1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160337678 Original CRISPR CAGAAAAAGGAGAGAGTGGC TGG Intergenic
No off target data available for this crispr