ID: 1160341078

View in Genome Browser
Species Human (GRCh38)
Location 18:78089265-78089287
Sequence TGAAAGCTAGACCTCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160341070_1160341078 28 Left 1160341070 18:78089214-78089236 CCAGAAATACATTTTGAAGTCCA No data
Right 1160341078 18:78089265-78089287 TGAAAGCTAGACCTCCTGGGAGG No data
1160341069_1160341078 29 Left 1160341069 18:78089213-78089235 CCCAGAAATACATTTTGAAGTCC No data
Right 1160341078 18:78089265-78089287 TGAAAGCTAGACCTCCTGGGAGG No data
1160341073_1160341078 8 Left 1160341073 18:78089234-78089256 CCATCATGAAGCAGGTTGGAAGG No data
Right 1160341078 18:78089265-78089287 TGAAAGCTAGACCTCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160341078 Original CRISPR TGAAAGCTAGACCTCCTGGG AGG Intergenic
No off target data available for this crispr