ID: 1160354184

View in Genome Browser
Species Human (GRCh38)
Location 18:78213047-78213069
Sequence CGCCTGTCAGGTGTCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160354181_1160354184 -10 Left 1160354181 18:78213034-78213056 CCTGCTGGGGCAACGCCTGTCAG No data
Right 1160354184 18:78213047-78213069 CGCCTGTCAGGTGTCTCCATGGG No data
1160354179_1160354184 -1 Left 1160354179 18:78213025-78213047 CCTCAGTGCCCTGCTGGGGCAAC No data
Right 1160354184 18:78213047-78213069 CGCCTGTCAGGTGTCTCCATGGG No data
1160354180_1160354184 -9 Left 1160354180 18:78213033-78213055 CCCTGCTGGGGCAACGCCTGTCA No data
Right 1160354184 18:78213047-78213069 CGCCTGTCAGGTGTCTCCATGGG No data
1160354175_1160354184 27 Left 1160354175 18:78212997-78213019 CCACGTAAGCGGTCAATGATGCT No data
Right 1160354184 18:78213047-78213069 CGCCTGTCAGGTGTCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160354184 Original CRISPR CGCCTGTCAGGTGTCTCCAT GGG Intergenic
No off target data available for this crispr