ID: 1160354607

View in Genome Browser
Species Human (GRCh38)
Location 18:78216379-78216401
Sequence CAGGGCCGCCTGAACATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160354601_1160354607 30 Left 1160354601 18:78216326-78216348 CCACACCTGAGTGTTCAATGGCT No data
Right 1160354607 18:78216379-78216401 CAGGGCCGCCTGAACATTTGTGG No data
1160354602_1160354607 25 Left 1160354602 18:78216331-78216353 CCTGAGTGTTCAATGGCTCGCAG No data
Right 1160354607 18:78216379-78216401 CAGGGCCGCCTGAACATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160354607 Original CRISPR CAGGGCCGCCTGAACATTTG TGG Intergenic
No off target data available for this crispr