ID: 1160355447

View in Genome Browser
Species Human (GRCh38)
Location 18:78224467-78224489
Sequence ATTCCTTGCCTGCCATGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160355446_1160355447 -8 Left 1160355446 18:78224452-78224474 CCAAACATTTTTGGAATTCCTTG No data
Right 1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG No data
1160355443_1160355447 23 Left 1160355443 18:78224421-78224443 CCTTTTCTTTGGGAGAATGGAGC No data
Right 1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG No data
1160355445_1160355447 -4 Left 1160355445 18:78224448-78224470 CCGACCAAACATTTTTGGAATTC No data
Right 1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160355447 Original CRISPR ATTCCTTGCCTGCCATGAAG AGG Intergenic
No off target data available for this crispr