ID: 1160356858

View in Genome Browser
Species Human (GRCh38)
Location 18:78235398-78235420
Sequence ATTTATCAGCAAAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160356858_1160356864 23 Left 1160356858 18:78235398-78235420 CCAACCAGCTTTTGCTGATAAAT No data
Right 1160356864 18:78235444-78235466 CCTAGGAATTTGGGTCTTATTGG No data
1160356858_1160356862 14 Left 1160356858 18:78235398-78235420 CCAACCAGCTTTTGCTGATAAAT No data
Right 1160356862 18:78235435-78235457 TATATTAGACCTAGGAATTTGGG No data
1160356858_1160356860 6 Left 1160356858 18:78235398-78235420 CCAACCAGCTTTTGCTGATAAAT No data
Right 1160356860 18:78235427-78235449 CACGTTCATATATTAGACCTAGG No data
1160356858_1160356861 13 Left 1160356858 18:78235398-78235420 CCAACCAGCTTTTGCTGATAAAT No data
Right 1160356861 18:78235434-78235456 ATATATTAGACCTAGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160356858 Original CRISPR ATTTATCAGCAAAAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr