ID: 1160357891

View in Genome Browser
Species Human (GRCh38)
Location 18:78244192-78244214
Sequence TGTGTGCGCGTGTGTGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160357891_1160357894 -6 Left 1160357891 18:78244192-78244214 CCCACTTCACACACGCGCACACA No data
Right 1160357894 18:78244209-78244231 CACACACACACACACACAAAGGG No data
1160357891_1160357896 11 Left 1160357891 18:78244192-78244214 CCCACTTCACACACGCGCACACA No data
Right 1160357896 18:78244226-78244248 AAAGGGAATATGTGGAAGTGTGG No data
1160357891_1160357895 3 Left 1160357891 18:78244192-78244214 CCCACTTCACACACGCGCACACA No data
Right 1160357895 18:78244218-78244240 ACACACACAAAGGGAATATGTGG No data
1160357891_1160357893 -7 Left 1160357891 18:78244192-78244214 CCCACTTCACACACGCGCACACA No data
Right 1160357893 18:78244208-78244230 GCACACACACACACACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160357891 Original CRISPR TGTGTGCGCGTGTGTGAAGT GGG (reversed) Intergenic