ID: 1160359955

View in Genome Browser
Species Human (GRCh38)
Location 18:78266801-78266823
Sequence CCAAGGCCAAGGTGTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160359955_1160359961 -3 Left 1160359955 18:78266801-78266823 CCCTCATGACACCTTGGCCTTGG No data
Right 1160359961 18:78266821-78266843 TGGACTCCCAGCCTCCAGGTTGG No data
1160359955_1160359967 14 Left 1160359955 18:78266801-78266823 CCCTCATGACACCTTGGCCTTGG No data
Right 1160359967 18:78266838-78266860 GGTTGGGATAAAATCAATGTTGG No data
1160359955_1160359959 -7 Left 1160359955 18:78266801-78266823 CCCTCATGACACCTTGGCCTTGG No data
Right 1160359959 18:78266817-78266839 GCCTTGGACTCCCAGCCTCCAGG No data
1160359955_1160359962 -2 Left 1160359955 18:78266801-78266823 CCCTCATGACACCTTGGCCTTGG No data
Right 1160359962 18:78266822-78266844 GGACTCCCAGCCTCCAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160359955 Original CRISPR CCAAGGCCAAGGTGTCATGA GGG (reversed) Intergenic