ID: 1160364335

View in Genome Browser
Species Human (GRCh38)
Location 18:78311633-78311655
Sequence CTCGGTTTCCCAAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160364335_1160364346 17 Left 1160364335 18:78311633-78311655 CCCGCTTCCCTTGGGAAACCGAG No data
Right 1160364346 18:78311673-78311695 CCTGTTCCTGGCCCACCCTGAGG No data
1160364335_1160364343 5 Left 1160364335 18:78311633-78311655 CCCGCTTCCCTTGGGAAACCGAG No data
Right 1160364343 18:78311661-78311683 CTGAAGCACGTCCCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160364335 Original CRISPR CTCGGTTTCCCAAGGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr