ID: 1160366954

View in Genome Browser
Species Human (GRCh38)
Location 18:78334748-78334770
Sequence GGGAAAATGACACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160366954_1160366962 16 Left 1160366954 18:78334748-78334770 CCAGATTTTGGTGTCATTTTCCC No data
Right 1160366962 18:78334787-78334809 ACGTTGCTGGCTGCACTCCGTGG No data
1160366954_1160366958 3 Left 1160366954 18:78334748-78334770 CCAGATTTTGGTGTCATTTTCCC No data
Right 1160366958 18:78334774-78334796 TATGCCCCTGTGCACGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160366954 Original CRISPR GGGAAAATGACACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr