ID: 1160369966

View in Genome Browser
Species Human (GRCh38)
Location 18:78363745-78363767
Sequence GACGGCACGCCTGCTGCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160369961_1160369966 3 Left 1160369961 18:78363719-78363741 CCGGGGCGCACACCCTCCGGGAT No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369956_1160369966 9 Left 1160369956 18:78363713-78363735 CCGACCCCGGGGCGCACACCCTC No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369958_1160369966 5 Left 1160369958 18:78363717-78363739 CCCCGGGGCGCACACCCTCCGGG No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369963_1160369966 -9 Left 1160369963 18:78363731-78363753 CCCTCCGGGATGAAGACGGCACG No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369950_1160369966 24 Left 1160369950 18:78363698-78363720 CCTGCCCAGCTGCGGCCGACCCC No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369953_1160369966 20 Left 1160369953 18:78363702-78363724 CCCAGCTGCGGCCGACCCCGGGG No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369960_1160369966 4 Left 1160369960 18:78363718-78363740 CCCGGGGCGCACACCCTCCGGGA No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369955_1160369966 19 Left 1160369955 18:78363703-78363725 CCAGCTGCGGCCGACCCCGGGGC No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data
1160369964_1160369966 -10 Left 1160369964 18:78363732-78363754 CCTCCGGGATGAAGACGGCACGC No data
Right 1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160369966 Original CRISPR GACGGCACGCCTGCTGCGCA CGG Intergenic
No off target data available for this crispr