ID: 1160369974

View in Genome Browser
Species Human (GRCh38)
Location 18:78363811-78363833
Sequence CGTGACACTCGACACAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160369974_1160369981 8 Left 1160369974 18:78363811-78363833 CCCGGTTTGTGTCGAGTGTCACG No data
Right 1160369981 18:78363842-78363864 GATGCCTTAAGGCTCCGGCTTGG No data
1160369974_1160369980 3 Left 1160369974 18:78363811-78363833 CCCGGTTTGTGTCGAGTGTCACG No data
Right 1160369980 18:78363837-78363859 ATGGAGATGCCTTAAGGCTCCGG No data
1160369974_1160369983 12 Left 1160369974 18:78363811-78363833 CCCGGTTTGTGTCGAGTGTCACG No data
Right 1160369983 18:78363846-78363868 CCTTAAGGCTCCGGCTTGGACGG No data
1160369974_1160369979 -3 Left 1160369974 18:78363811-78363833 CCCGGTTTGTGTCGAGTGTCACG No data
Right 1160369979 18:78363831-78363853 ACGGGAATGGAGATGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160369974 Original CRISPR CGTGACACTCGACACAAACC GGG (reversed) Intergenic