ID: 1160370109

View in Genome Browser
Species Human (GRCh38)
Location 18:78365011-78365033
Sequence GAGAAATATCCCTGCTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160370102_1160370109 16 Left 1160370102 18:78364972-78364994 CCTGTCTTACCAGCTACACGCGT No data
Right 1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG No data
1160370101_1160370109 24 Left 1160370101 18:78364964-78364986 CCAACAGACCTGTCTTACCAGCT No data
Right 1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG No data
1160370100_1160370109 25 Left 1160370100 18:78364963-78364985 CCCAACAGACCTGTCTTACCAGC No data
Right 1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG No data
1160370106_1160370109 7 Left 1160370106 18:78364981-78365003 CCAGCTACACGCGTGGGGCAGTA No data
Right 1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160370109 Original CRISPR GAGAAATATCCCTGCTATGA TGG Intergenic
No off target data available for this crispr