ID: 1160370618

View in Genome Browser
Species Human (GRCh38)
Location 18:78369570-78369592
Sequence CCCAGGAAGGCTCAGTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160370601_1160370618 29 Left 1160370601 18:78369518-78369540 CCTCCTAGGCATCCAGGCAGAGG No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370610_1160370618 3 Left 1160370610 18:78369544-78369566 CCTCCCCGACAGCGCTCTGGGGG No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370604_1160370618 26 Left 1160370604 18:78369521-78369543 CCTAGGCATCCAGGCAGAGGGAC No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370608_1160370618 4 Left 1160370608 18:78369543-78369565 CCCTCCCCGACAGCGCTCTGGGG No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370613_1160370618 -1 Left 1160370613 18:78369548-78369570 CCCGACAGCGCTCTGGGGGCAGC No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370612_1160370618 0 Left 1160370612 18:78369547-78369569 CCCCGACAGCGCTCTGGGGGCAG No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370614_1160370618 -2 Left 1160370614 18:78369549-78369571 CCGACAGCGCTCTGGGGGCAGCC No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data
1160370605_1160370618 17 Left 1160370605 18:78369530-78369552 CCAGGCAGAGGGACCCTCCCCGA No data
Right 1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160370618 Original CRISPR CCCAGGAAGGCTCAGTGCTG CGG Intergenic
No off target data available for this crispr